How to recalculate variants in phase that are called separately?

In the rare case variants, such as MNPs (multi-nucleotide polymorphisms) delinses, are split into smaller atomic SNVs (single nucleotide variants) or INDELs (insertions and deletions), they may need to be recalculated into a single MNP. This process is important for accurate classification, especially when determining if two variants are in phase or are independent. This article explains how to recalculate split variants into a single MNP using VarSome Clinical, with a detailed example from a clinical case.

Case example: ENG gene variants

Consider a case where we have two variants in the ENG gene, and the end user is seeking confirmation about whether these two variants are in phase and should be analyzed together or if they are independent in the hg19 reference genome:

• Variant 1: NM_001114753.3:c.466_471del(p.Ile156_Thr157del)
• Variant 2: NM_001114753.3:c.445_458del(p.Trp149GlyfsTer8)

Step 1: Identifying other potential involved variants

Before determining whether the variants are in phase, it is useful to check for other variants in the genomic neighborhood that might be involved. Here’s how to identify them:

1. Nearby Variants card: In VarSome Clinical, navigate to the Nearby Variants section in the clinical card for the selected variant. This will display variants in the genomic neighborhood of your variant.

2. Not affected by sample filters: This list will not be affected by any filters applied to the sample, so it provides a comprehensive look at other variants in the area.

3. Check PGT and PID for nearby variants: By reviewing these nearby variants, you can assess if any of them share the same PGT and PID attributes, suggesting that they might also be in phase or linked to the variants in question.

Step 2: Determine if the variants are in phase

To determine if the two variants are in phase, follow these steps within VarSome Clinical:

1. Search for VCF attributes PGT and PID:

   • PGT (Physical Phasing Haplotype Information): Describes how the alternate alleles are phased relative to one another (e.g., 0|1 or 1|0).
   • PID (Physical Phasing ID Information): A unique ID within a sample that connects records within a phasing group.

2. Comparing PGT and PID: In VarSome Clinical, these attributes will appear in the variant details (as shown in the example image below). Compare the PGT and PID values for both variants.

   

   Key rule: If two variants share the same PGT and PID, they are not independent, meaning they are on the same haplotype and therefore in phase. This means the variants should not be analyzed separately.

3. Conclusion: In this case, if the PGT and PID for both variants are identical, they are in phase. As a result, they should be recalculated into a single variant.

Step 3: Recalculate the variant

Once you determine that the variants are in phase, you need to recalculate the two split variants into a single MNP. Here’s how to do that:

1. Reference sequence: Start with the reference sequence where the two variants occur:

   GGTGATGGGGCCCCTCTCAGCTGCCCA

   • Variant 1 (c.466_471del) is the underlined first 6 nucleotides.
   • Variant 2 (c.445_458del) is the second underlined segment of 14 nucleotides.

2. Resulting sequence after deletions: These two deletions occur at the same time, which means the combined result is the deletion of the bases from both variants. The resulting sequence will be:

   GGGGCCC


3. Formulate the query: Use the resulting sequence to create a new VarSome query:

   chr9:130588841:GGTGATGGGGCCCCTCTCAGCTGCCCA:GGGGCCC


   This will give you the merged variant.

4. Recalculated variant: The recalculated variant is now:

   ENG(NM_001114753.3):c.445_469delinsGGGCC p.(Trp149GlyfsTer6)


   This is the single MNP that combines the two original variants.

Using the PGT and PID attributes in VarSome Clinical, you can easily determine if variants are in phase and merge them accordingly. The recalculation process helps ensure a more accurate analysis of genetic variants.